Fulgor is a colored de Bruijn graph index for large-scale matching and color queries, powered by SSHash and GGCAT.
The Fulgor index is described in the following papers.
- Fulgor: A Fast and Compact k-mer Index for Large-Scale Matching and Color Queries (Algorithms for Molecular Biology, ALMOB 2024), and
- Meta-colored compacted de Bruijn graphs (International Conference on Research in Computational Molecular Biology, RECOMB 2024).
- Where the patterns are: repetition-aware compression for colored de Bruijn graphs (Journal of Computational Biology, JCB 2024).
- Fast pseudoalignment queries on compressed colored de Bruijn graphs (International Conference on Algorithms for Bioinformatics, WABI 2025).
Please, cite these papers if you use Fulgor.
- Dependencies
- Compiling the code
- Tools and usage
- Quick start
- Indexing an example Salmonella Enterica pangenome
- Pseudoalignment output format
- Kmer conservation output format
- Dump output format
The code uses the GGCAT Rust library, so make sure you have Rust installed. If not, Rust can be installed as recommended here, with
curl --proto '=https' --tlsv1.2 -sSf https://sh.rustup.rs | sh
If you do not have zlib installed, you can do
sudo apt-get install zlib1g
if you are on Linux/Ubuntu, or
brew install zlib
if you are using MacOS.
The code is tested on Linux with gcc and on MacOS with clang.
To build the code, CMake is required.
First clone the repository with
git clone https://github.com/jermp/fulgor.git
and then do
git submodule update --init --recursive
to pull all necessary submodules before compilation.
To compile the code for a release environment (see file CMakeLists.txt for the used compilation flags), it is sufficient to do the following, within the parent fulgor directory:
mkdir build
cd build
cmake ..
make -j
For a testing environment, use the following instead:
mkdir debug_build
cd debug_build
cmake .. -D CMAKE_BUILD_TYPE=Debug -D FULGOR_USE_SANITIZERS=On
make -j
There is one executable called fulgor after the compilation, which can be used to run a tool.
Run ./fulgor help to see a list of available tools.
== Fulgor: a colored de Bruijn graph index ========================================
Usage: ./fulgor <tool> ...
Construction:
build build an index
color build a meta- or a diff- or a meta-diff- index
permute permute the reference names of an index
Queries:
pseudoalign perform pseudoalignment to an index
kmer-conservation print color set info for each positive kmer in query
Debug:
check perform an in-depth check to verify that an index was built correctly.
verify verify that index works correctly with current library version
stats print index statistics
print-filenames print all reference filenames
dump write unitigs and color sets of an index in text format
Other:
help print this helper and exit gracefully
For large-scale indexing, it could be necessary to increase the number of file descriptors that can be opened simultaneously:
ulimit -n 2048
This short demo shows how to index the 10-genome collection
in the folder test_data/salmonella_10 with Fulgor.
We will use the standard value k = 31.
First create a list of filenames (with absolute paths) for the files in test_data/salmonella_10.
From fulgor/test_data, do
find $(pwd)/salmonella_10/* > salmonella_10_filenames.txt
Then, from fulgor/build, run
./fulgor build -l ../test_data/salmonella_10_filenames.txt -o ../test_data/salmonella_10 -k 31 -m 19 -d tmp_dir -g 1 -t 1 --verbose --check
to build an index that will be serialized to the file test_data/salmonella_10.fur.
In this example, we will build a Fulgor index, with k = 31, for the 4,546 Salmonella genomes that can be downloaded from here
with (assuming you have wget installed)
wget https://zenodo.org/records/1323684/files/Salmonella_enterica.zip
unzip Salmonella_enterica.zip
We assume all commands are issue from within the home (~/) directory.
After download, create a list of all .fasta filenames with
find $(pwd)/Salmonella_enterica/Genomes/*.fasta > salmonella_4546_filenames.txt
and, from fulgor/build, run
./fulgor build -l ~/salmonella_4546_filenames.txt -o ~/Salmonella_enterica/salmonella_4546 -k 31 -m 20 -d tmp_dir -g 8 -t 8 --verbose --check
which will create an index named ~/Salmonella_enterica/salmonella_4546.fur of 0.266 GB.
We can now pseudoalign the reads from SRR801268, as follows.
First, download the reads in ~/ with
cd
wget ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR801/SRR801268/SRR801268_1.fastq.gz
and then process them with
./fulgor pseudoalign -i ~/Salmonella_enterica/salmonella_4546.fur -q ~/SRR801268_1.fastq.gz -t 8 --verbose -o /dev/null
mapped 6584304 reads
elapsed = 130133 millisec / 130.133 sec / 2.16888 min / 19.7641 musec/read
num_mapped_reads 5796427/6584304 (88.034%)
using 8 parallel threads and writing the mapping output to /dev/null.
To partition the index to obtain a meta-colored Fulgor index, then do:
./fulgor color -i ~/Salmonella_enterica/salmonella_4546.fur -d tmp_dir --meta --check
We can change the option --meta to --diff to create a differential-colored index, or use
both options, --meta --diff, to create a meta-differential-colored index.
See the table below.
| command | output file | size (GB) | compression factor |
|---|---|---|---|
color --meta |
salmonella_4546.mfur |
0.11769 | 2.26 |
color --diff |
salmonella_4546.dfur |
0.11076 | 2.40 |
color --meta --diff |
salmonella_4546.mdfur |
0.09389 | 2.84 |
The following table is taken from the paper "Where the patters are: repetition-aware compression for colored de Bruijn graphs" and shows the size of the various Fulgor indexes on several larger pangenomes.
The tool pseudoalign writes the result to an output file, in plain text format, specified with the option -o [output-filename].
This file has one line for each mapped read, formatted as follows:
[read-id][TAB][list-lenght][TAB][list]
where [list] is a TAB-separated list of increasing integers, of length [list-length], representing the list of reference identifiers to which the read is mapped. ([TAB] is the character \t.)
1 1 0
2 1 0
3 3 0 3 7
4 1 0
5 2 0 8
6 1 0
7 1 0
Note: Read ids might not be consecutive in the output file if multiple threads are used to perform the queries.
If pseudoalignment is performed against a meta-colored
or a differential-meta-colored Fulgor index,
the reference identifiers in the pseudoalignment output might not correspond to the ones assigned following the input-file order as specified with option -l during index construction.
This is because the meta-colored index re-assignes identifiers to references to improve index compression.
In this case, the reference identifiers in the pseudoalignment output
are consistent with the ones returned by the print-filenames tool.
The tool kmer-conservation writes the result to an output file, in plain text format, specified with the option -o [output-filename].
This file has one line for each processed read, formatted as follows:
[read-name][TAB][list-lenght][TAB][list]
where [list] is a TAB-separated list of integer triples, of length [list-length].
([TAB] is the character \t.)
If a triple is (p n i), it means that the n kmers starting at position p in the query all have color set id i.
Obtaining an iterator over the actual color set of id i, is as simple as
auto it = index.color_set(i);where the variable it is the iterator and it.size() is the size of the color set.
SRR801268.985 2 (0 16 1) (16 7 3)
SRR801268.986 3 (0 12 1) (12 6 3) (18 5 1)
SRR801268.987 1 (0 23 1)
SRR801268.988 1 (0 8 3)
For example, in the second query, the triple (12 6 3) indicates that the 6 kmers starting at position 12 in the query all have color set id 3.
The tool dump writes in plain textual format the content of an index.
In particular, it outputs three files:
[basename].metadata.txt[basename].unitigs.fa[basename].color_sets.txt
where [basename] is a chosen output name.
The file [basename].metadata.txt contains the following basic statistics (one per line and in the following order): the value of k, the number of distinct kmers, the number of colors, the number of unitigs, and the number of color sets, using a simple key=value format.
Example:
k=31
num_kmers=43788757
num_colors=4546
num_unitigs=1884865
num_color_sets=972178
Important note: The values of num_unitigs and num_color_sets could (slightly) change if the index is re-built because GGCAT does not compute maximal unitigs.
The file [basename].unitigs.fa contains the unitig sequences written in FASTA format.
Each sequence has a header containing the id of the unitig (an increasing integer id) and the id of the corresponding color set.
Example:
(...)
> unitig_id=13 color_set_id=0
TGGTTCTGGCGTGCTCCAGCTCATCCAGCATTGCCAGCACA
> unitig_id=14 color_set_id=0
CGATAAGGAATGGCTTGAAAAGCCAACAGAACAACGTCATCTCTCAGATCTGCTTCCGTTA
> unitig_id=15 color_set_id=0
GGAGCGGATTTTCTCCGTGAAATTCCCCAGCATTTGTCAGGAGTGTAAACATTCCTCCGAG
> unitig_id=16 color_set_id=0
ATTTGCTTTACCTGCCGCAGCTTAACAAGCGCCAGATACAGACGCTGGCCACCATGACGGC
> unitig_id=17 color_set_id=0
GGTCTTACCTGTGCGGCGGGAAAACTCATCAACGGTGATGGGGTCTGGGATCTTAAACAAT
> unitig_id=18 color_set_id=1
CGATAAGGAATGGCTTGAAAAGCCAACAGAGCAACGTCATCTCTCAGATCTGCTTCCGTTA
> unitig_id=19 color_set_id=1
ATTGTTTAAGATCCCAGACCCCATCACCGTCGATGA
> unitig_id=20 color_set_id=2
CTTGCTATGAGTTGCGGTTTTTTGATCCTGCCCCAGCGGTTCAGCAAGCGTCCTGACATACTGGCAACATCCTTTTCCTTCATGAACTCCAGCATTAACTCGTTGTGCTCTCTTTGGTATGAGTGAGCCATCTCCATCAG
> unitig_id=21 color_set_id=2
CACTTTCTAAAAGGTAAAGACGCTATGAATCATCAATTGGCTAATCTCGATTTCCGGGACATGGTGGTTGTTTCTGGTGATCGCGTGATCACAACCTCCCGCAAGGTAGCAGCTTACTTCGACAAGCAGCATCACCACATCATTCAGAAAATCGAAAAGCTAGACTGTTCGGATGAATTTCTAACCAGCAACTTTTCGCGGGTTACCTATGAACACAAGGGTAATCAGTATGTTGAATATGAAATTTCCAAAGACGGTGCGATGTACATCATCATGTCGTTTACCGGCAAAAAAGCTGCCGCCATCAAAGAGGCGTTTATCAAAGCATTTAATTGGATGCGTGACAG
(...)
In this example the unitigs 13, 14, 15, 16, and 17 have the same color set (whose id is 0), the unitigs 18 and 19 have the same color set (of id is 1), and the unitigs 20 and 21 have the name color set (of id 2).
Lastly, the file [basename].color_sets.txt lists the color sets, one per line.
Each color set is written as color_set_id=[X] size=[Y] [color-set], where [X] is the id of the set, [Y] its size, and [color-set] a space-separated list of [Y] increasing integers.
Example:
color_set_id=0 size=3 424 3145 3578
color_set_id=1 size=49 163 440 454 635 667 684 998 1703 1730 1735 1760 1812 1814 1815 1817 1819 1834 1842 1874 1881 2011 2036 2047 2185 2245 2301 2321 2356 2669 2687 2788 2897 2960 2961 2965 3057 3163 3461 3519 3805 3806 3960 3967 3976 4105 4119 4159 4183 4385
color_set_id=2 size=3 1384 1693 3645
(...)
