Fulgor is a colored de Bruijn graph index for large-scale matching and color queries, powered by SSHash and GGCAT.

The Fulgor index is described in the following papers.

• Fulgor: A Fast and Compact k-mer Index for Large-Scale Matching and Color Queries (Algorithms for Molecular Biology, ALMOB 2024), and
• Meta-colored compacted de Bruijn graphs (International Conference on Research in Computational Molecular Biology, RECOMB 2024).
• Where the patterns are: repetition-aware compression for colored de Bruijn graphs (Journal of Computational Biology, JCB 2024).
• Fast pseudoalignment queries on compressed colored de Bruijn graphs (International Conference on Algorithms for Bioinformatics, WABI 2025).

Please, cite these papers if you use Fulgor.

Table of contents

• Dependencies
• Compiling the code
• Tools and usage
• Quick start
• Indexing an example Salmonella Enterica pangenome
• Pseudoalignment output format
• Kmer conservation output format
• Dump output format

Dependencies

GGCAT

The code uses the GGCAT Rust library, so make sure you have Rust installed. If not, Rust can be installed as recommended here, with

curl --proto '=https' --tlsv1.2 -sSf https://sh.rustup.rs | sh

zlib

If you do not have zlib installed, you can do

sudo apt-get install zlib1g

if you are on Linux/Ubuntu, or

brew install zlib

if you are using MacOS.

Compiling the code

The code is tested on Linux with gcc and on MacOS with clang. To build the code, CMake is required.

First clone the repository with

git clone https://github.com/jermp/fulgor.git

and then do

git submodule update --init --recursive

to pull all necessary submodules before compilation.

To compile the code for a release environment (see file CMakeLists.txt for the used compilation flags), it is sufficient to do the following, within the parent fulgor directory:

mkdir build
cd build
cmake ..
make -j

For a testing environment, use the following instead:

mkdir debug_build
cd debug_build
cmake .. -D CMAKE_BUILD_TYPE=Debug -D FULGOR_USE_SANITIZERS=On
make -j

Tools and usage

There is one executable called fulgor after the compilation, which can be used to run a tool. Run ./fulgor help to see a list of available tools.

== Fulgor: a colored de Bruijn graph index ========================================

Usage: ./fulgor <tool> ...

Construction:
  build              build an index
  color              build a meta- or a diff- or a meta-diff- index
  permute            permute the reference names of an index

Queries:
  pseudoalign        perform pseudoalignment to an index
  kmer-conservation  print color set info for each positive kmer in query

Debug:
  check              perform an in-depth check to verify that an index was built correctly.
  verify             verify that index works correctly with current library version
  stats              print index statistics
  print-filenames    print all reference filenames
  dump               write unitigs and color sets of an index in text format

Other:
  help               print this helper and exit gracefully

For large-scale indexing, it could be necessary to increase the number of file descriptors that can be opened simultaneously:

ulimit -n 2048

Quick start

This short demo shows how to index the 10-genome collection in the folder test_data/salmonella_10 with Fulgor. We will use the standard value k = 31.

First create a list of filenames (with absolute paths) for the files in test_data/salmonella_10. From fulgor/test_data, do

find $(pwd)/salmonella_10/* > salmonella_10_filenames.txt

Then, from fulgor/build, run

./fulgor build -l ../test_data/salmonella_10_filenames.txt -o ../test_data/salmonella_10 -k 31 -m 19 -d tmp_dir -g 1 -t 1 --verbose --check

to build an index that will be serialized to the file test_data/salmonella_10.fur.

Indexing an example Salmonella Enterica pangenome

In this example, we will build a Fulgor index, with k = 31, for the 4,546 Salmonella genomes that can be downloaded from here with (assuming you have wget installed)

wget https://zenodo.org/records/1323684/files/Salmonella_enterica.zip
unzip Salmonella_enterica.zip

We assume all commands are issue from within the home (~/) directory.

After download, create a list of all .fasta filenames with

find $(pwd)/Salmonella_enterica/Genomes/*.fasta > salmonella_4546_filenames.txt

and, from fulgor/build, run

./fulgor build -l ~/salmonella_4546_filenames.txt -o ~/Salmonella_enterica/salmonella_4546 -k 31 -m 20 -d tmp_dir -g 8 -t 8 --verbose --check

which will create an index named ~/Salmonella_enterica/salmonella_4546.fur of 0.266 GB.

We can now pseudoalign the reads from SRR801268, as follows.

First, download the reads in ~/ with

cd
wget ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR801/SRR801268/SRR801268_1.fastq.gz

and then process them with

./fulgor pseudoalign -i ~/Salmonella_enterica/salmonella_4546.fur -q ~/SRR801268_1.fastq.gz -t 8 --verbose -o /dev/null

mapped 6584304 reads
elapsed = 130133 millisec / 130.133 sec / 2.16888 min / 19.7641 musec/read
num_mapped_reads 5796427/6584304 (88.034%)

using 8 parallel threads and writing the mapping output to /dev/null.

To partition the index to obtain a meta-colored Fulgor index, then do:

./fulgor color -i ~/Salmonella_enterica/salmonella_4546.fur -d tmp_dir --meta --check

We can change the option --meta to --diff to create a differential-colored index, or use both options, --meta --diff, to create a meta-differential-colored index. See the table below.

command	output file	size (GB)	compression factor
color --meta	salmonella_4546.mfur	0.11769	2.26
color --diff	salmonella_4546.dfur	0.11076	2.40
color --meta --diff	salmonella_4546.mdfur	0.09389	2.84

The following table is taken from the paper "Where the patters are: repetition-aware compression for colored de Bruijn graphs" and shows the size of the various Fulgor indexes on several larger pangenomes.

Pseudoalignment output format

The tool pseudoalign writes the result to an output file, in plain text format, specified with the option -o [output-filename].

This file has one line for each mapped read, formatted as follows:

[read-id][TAB][list-lenght][TAB][list]

where [list] is a TAB-separated list of increasing integers, of length [list-length], representing the list of reference identifiers to which the read is mapped. ([TAB] is the character \t.)

Example

1	1	0
2	1	0
3	3	0	3	7
4	1	0
5	2	0	8
6	1	0
7	1	0

Note: Read ids might not be consecutive in the output file if multiple threads are used to perform the queries.

Important note

If pseudoalignment is performed against a meta-colored or a differential-meta-colored Fulgor index, the reference identifiers in the pseudoalignment output might not correspond to the ones assigned following the input-file order as specified with option -l during index construction. This is because the meta-colored index re-assignes identifiers to references to improve index compression.

In this case, the reference identifiers in the pseudoalignment output are consistent with the ones returned by the print-filenames tool.

Kmer conservation output format

The tool kmer-conservation writes the result to an output file, in plain text format, specified with the option -o [output-filename].

This file has one line for each processed read, formatted as follows:

[read-name][TAB][list-lenght][TAB][list]

where [list] is a TAB-separated list of integer triples, of length [list-length]. ([TAB] is the character \t.) If a triple is (p n i), it means that the n kmers starting at position p in the query all have color set id i.

Obtaining an iterator over the actual color set of id i, is as simple as

auto it = index.color_set(i);

where the variable it is the iterator and it.size() is the size of the color set.

Example

SRR801268.985	2	(0 16 1)	(16 7 3)
SRR801268.986	3	(0 12 1)	(12 6 3)	(18 5 1)
SRR801268.987	1	(0 23 1)
SRR801268.988	1	(0 8 3)

For example, in the second query, the triple (12 6 3) indicates that the 6 kmers starting at position 12 in the query all have color set id 3.

Dump output format

The tool dump writes in plain textual format the content of an index. In particular, it outputs three files:

• [basename].metadata.txt
• [basename].unitigs.fa
• [basename].color_sets.txt

where [basename] is a chosen output name.

The file [basename].metadata.txt contains the following basic statistics (one per line and in the following order): the value of k, the number of distinct kmers, the number of colors, the number of unitigs, and the number of color sets, using a simple key=value format.

Example:

k=31
num_kmers=43788757
num_colors=4546
num_unitigs=1884865
num_color_sets=972178

Important note: The values of num_unitigs and num_color_sets could (slightly) change if the index is re-built because GGCAT does not compute maximal unitigs.

The file [basename].unitigs.fa contains the unitig sequences written in FASTA format. Each sequence has a header containing the id of the unitig (an increasing integer id) and the id of the corresponding color set.

Example:

(...)
> unitig_id=13 color_set_id=0
TGGTTCTGGCGTGCTCCAGCTCATCCAGCATTGCCAGCACA
> unitig_id=14 color_set_id=0
CGATAAGGAATGGCTTGAAAAGCCAACAGAACAACGTCATCTCTCAGATCTGCTTCCGTTA
> unitig_id=15 color_set_id=0
GGAGCGGATTTTCTCCGTGAAATTCCCCAGCATTTGTCAGGAGTGTAAACATTCCTCCGAG
> unitig_id=16 color_set_id=0
ATTTGCTTTACCTGCCGCAGCTTAACAAGCGCCAGATACAGACGCTGGCCACCATGACGGC
> unitig_id=17 color_set_id=0
GGTCTTACCTGTGCGGCGGGAAAACTCATCAACGGTGATGGGGTCTGGGATCTTAAACAAT
> unitig_id=18 color_set_id=1
CGATAAGGAATGGCTTGAAAAGCCAACAGAGCAACGTCATCTCTCAGATCTGCTTCCGTTA
> unitig_id=19 color_set_id=1
ATTGTTTAAGATCCCAGACCCCATCACCGTCGATGA
> unitig_id=20 color_set_id=2
CTTGCTATGAGTTGCGGTTTTTTGATCCTGCCCCAGCGGTTCAGCAAGCGTCCTGACATACTGGCAACATCCTTTTCCTTCATGAACTCCAGCATTAACTCGTTGTGCTCTCTTTGGTATGAGTGAGCCATCTCCATCAG
> unitig_id=21 color_set_id=2
CACTTTCTAAAAGGTAAAGACGCTATGAATCATCAATTGGCTAATCTCGATTTCCGGGACATGGTGGTTGTTTCTGGTGATCGCGTGATCACAACCTCCCGCAAGGTAGCAGCTTACTTCGACAAGCAGCATCACCACATCATTCAGAAAATCGAAAAGCTAGACTGTTCGGATGAATTTCTAACCAGCAACTTTTCGCGGGTTACCTATGAACACAAGGGTAATCAGTATGTTGAATATGAAATTTCCAAAGACGGTGCGATGTACATCATCATGTCGTTTACCGGCAAAAAAGCTGCCGCCATCAAAGAGGCGTTTATCAAAGCATTTAATTGGATGCGTGACAG
(...)

In this example the unitigs 13, 14, 15, 16, and 17 have the same color set (whose id is 0), the unitigs 18 and 19 have the same color set (of id is 1), and the unitigs 20 and 21 have the name color set (of id 2).

Lastly, the file [basename].color_sets.txt lists the color sets, one per line. Each color set is written as color_set_id=[X] size=[Y] [color-set], where [X] is the id of the set, [Y] its size, and [color-set] a space-separated list of [Y] increasing integers.

Example:

color_set_id=0 size=3 424 3145 3578
color_set_id=1 size=49 163 440 454 635 667 684 998 1703 1730 1735 1760 1812 1814 1815 1817 1819 1834 1842 1874 1881 2011 2036 2047 2185 2245 2301 2321 2356 2669 2687 2788 2897 2960 2961 2965 3057 3163 3461 3519 3805 3806 3960 3967 3976 4105 4119 4159 4183 4385
color_set_id=2 size=3 1384 1693 3645
(...)